pROKII

价格:1500元

联系方式:I47-825O-882O

买家导航

载体基本信息

出品公司: --
载体名称: pROKII
质粒类型: 植物系列,蛋白过表达载体
终止子: NOS
复制子: ori
启动子: 35s
载体大小: 12880bp
5' 测序引物及序列: 35S:GACGCACAATCCCACTATCC
3' 测序引物及序列: --
载体标签: --
载体抗性: 卡那霉素
筛选标记: G418
克隆菌株: Stbl3
宿主细胞(系): --
备注: --
产品目录号: --
稳定性: --
组成型/诱导型: --
病毒/非病毒: --

载体质粒图谱和多克隆位点信息

pROKII载体图谱

载体简介

载体序列

LOCUS       PROKII               12880 bp ds-DNA     circular SYN 13-SEP-2016
DEFINITION  synthetic circular DNA
ACCESSION   .
VERSION     .
KEYWORDS    PROKII
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 12880)
  AUTHORS   .
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 13, 2016 from SnapGene Viewer 3.1.4
            http://www.biofeng.com/
FEATURES             Location/Qualifiers
     source          1..12880
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    2337..2784
                     /note="NeoR/KanR"
                     /note="TGAGCGTCGCAAAGGCGCTCGGTCTTGCCTTGCTCGTCGGTGATGTACTTCA
                      
                     CCAGCTCCGCGAAGTCGCTCTTCTTGATGGAGCGCATGGGGACGTGCTTGGCAATCACG
                      
                     CGCACCCCCCGGCCGTTTTAGCGGCTAAAAAAGTCATGGCTCTGCCCTCGGGCGGACCA
                      
                     CGCCCATCATGACCTTGCCAAGCTCGTCCTGCTTCTCTTCGATCTTCGCCAGCAGGGCG
                      
                     AGGATCGTGGCATCACCGAACCGCGCCGTGCGCGGGTCGTCGGTGAGCCAGAGTTTCAG
                      
                     CAGGCCGCCCAGGCGGCCCAGGTCGCCATTGATGCGGGCCAGCTCGCGGACGTGCTCAT
                      
                     AGTCCACGACGCCCGTGATTTTGTAGCCCTGGCCGACGGCCAGCAGGTAGGCCGACAGG
                      
                     CTCATGCCGGCCGCCGCCGCCTTTTCCTCAATCGCTCTTCGTTCGTCTGGAAGGCAGTA
                      
                     CACCTTGATAGGTGGGCTGCCCTTCCTGGTTGGCTTGGTTTCATCAGCCATCCGCTTGC
                      
                     CCTCATCTGTTACGCCGGCGGTAGCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGC
                      
                     ACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTAC
                      
                     TTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCC
                      
                     TTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATA
                      
                     ATGACCCCGAAGCAGGGTTATGCAGCGGAAAAGCGCCACGCTTCCCGAAGGGAGAAAGG
                      
                     CGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCA
                      
                     GGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCG
                      
                     TCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGG
                      
                     CCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTA
                      
                     TCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCG
                      
                     CAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCAGAAGG
                      
                     CCGCCAGAGAGGCCGAGCGCGGCCGTGAGGCTTGGACGCTAGGGCAGGGCATGAAAAAG
                      
                     CCCGTAGCGGGCTGCTACGGGCGTCTGACGCGGTGGAAAGGGGGAGGGGATGTTGTCTA
                      
                     CATGGCTCTGCTGTAGTGAGTGGGTTGCGCTCCGGCAGCGGTCCTGATCAATCGTCACC
                      
                     CTTTCTCGGTCCTTCAACGTTCCTGACAACGAGCCTCCTTTTCGCCAATCCATCGACAA
                      
                     TCACCGCGAGTCCCTGCTCGAACGCTGCGTCCGGACCGGCTTCGTCGAAGGCGTCTATC
                      
                     GCGGCCCGCAACAGCGGCGAGAGCGGAGCCTGTTCAACGGTGCCGCCGCGCTCGCCGGC
                      
                     ATCGCTGTCGCCGGCCTGCTCCTCAAGCACGGCCCCAACAGTGAAGTAGCTGATTGTCA
                      
                     TCAGCGCATTGACGGCGTCCCCGGCCGAAAAACCCGCCTCGCAGAGGAAGCGAAGCTGC
                      
                     GCGTCGGCCGTTTCCATCTGCGGTGCGCCCGGTCGCGTGCCGGCATGGATGCGCGCGCC
                      
                     ATCGCGGTAGGCGAGCAGCGCCTGCCTGAAGCTGCGGGCATTCCCGATCAGAAATGAGC
                      
                     GCCAGTCGTCGTCGGCTCTCGGCACCGAATGCGTATGATTCTCCGCCAGCATGGCTTCG
                      
                     GCCAGTGCGTCGAGCAGCGCCCGCTTGTTCCTGAAGTGCCAGTAAAGCGCCGGCTGCTG
                      
                     AACCCCCAACCGTTCCGCCAGTTTGCGTGTCGTCAGACCGTCTACGCCGACCTCGTTCA
                      
                     ACAGGTCCAGGGCGGCACGGATCACTGTATTCGGCTGCAACTTTGTCATGCTTGACACT
                      
                     TTATCACTGATAAACATAATATGTCCACCAACTTATCAGTGATAAAGAATCCGCGCGTT
                      
                     CAATCGGACCAGCGGAGGCTGGTCCGGAGGCCAGACGTGAAACCCAACATACCCCTGAT
                      
                     CGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGTGC
                      
                     TGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATT
                      
                     CTGCTGGCGCTGTATGCGTTGGTGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTC
                      
                     GGATCGTTTCGGGCGGCGGCCAATCTTGCTCGTCTCGCTGGCCGGCGCCAGATCTGGGG
                      
                     AACCCTGTGGTTGGCATGCACATACAAATGGACGAACGGATAAACCTTTTCACGCCCTT
                      
                     TTAAATATCCGATTATTCTAATAAACGCTCTTTTCTCTTAGGTTTACCCGCCAATATAT
                      
                     CCTGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGG
                      
                     AGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGT
                      
                     TTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTT
                      
                     AATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTC
                      
                     ACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCC
                      
                     CTCGGTATCCAATTAGAGTCTCATATTCACTCTCAATCCAAATAATCTGCACCGGATCT
                      
                     GGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGT
                      
                     GGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCG
                      
                     TGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT
                      
                     GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGT
                      
                     TCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGG
                      
                     GCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCC
                      
                     ATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGA
                      
                     CCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCG
                      
                     ATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGG
                      
                     CTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTT
                      
                     GCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGG
                      
                     GTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTT
                      
                     GGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCA
                      
                     GCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGA
                      
                     AATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCT
                      
                     TCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAG
                      
                     CGCGGGGATCTCATGCTGGAGTTCTTCGCCCACGGGATCTCTGCGGAACAGGCGGTCGA
                      
                     AGGTGCCGATATCATTACGACAGCAACGGCCGACAAGCACAACGCCACGATCCTGAGCG
                      
                     ACAATATGATCGGGCCCGGCGTCCACATCAACGGCGTCGGCGGCGACTGCCCAGGCAAG
                      
                     ACCGAGATGCACCGCGATATCTTGCTGCGTTCGGATATTTTCGTGGAGTTCCCGCCACA
                      
                     GACCCGGATGATCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATC
                      
                     CTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTA
                      
                     ATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCC
                      
                     GCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAAT
                      
                     TATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGCCTCCTGTCAATGCTGGCGGCGG
                      
                     CTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTG
                      
                     AGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGAT
                      
                     TATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGC
                      
                     GCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTA
                      
                     TCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGAT
                      
                     TTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAAT
                      
                     GAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTG
                      
                     TCTTTGGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGC
                      
                     TGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAG
                      
                     TTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGT
                      
                     GTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCC
                      
                     AAGCTTGCATGCCTGCAGGTCCCCAGATTAGCCTTTTCAATTTCAGAAAGAATGCTAAC
                      
                     CCACAGATGGTTAGAGAGGCTTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGCAA
                      
                     TAATCTCCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCA
                      
                     GGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATT
                      
                     CCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGGAGT
                      
                     CTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGAGG
                      
                     ACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTC
                      
                     AATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAA
                      
                     AAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGG
                      
                     TAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAG
                      
                     ATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCAT
                      
                     CGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCA
                      
                     TCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATC
                      
                     TCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTAT
                      
                     ATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGGACTCTAGAGGATCCCCGGGTAC
                      
                     CGAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAAT
                      
                     CCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGT
                      
                     AATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCC
                      
                     CGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAA
                      
                     TTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGAATTCACTGGCCGTCGTTTTAC
                      
                     AACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCC
                      
                     CCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTT
                      
                     GCGCAGCCTGAATGGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTC
                      
                     GCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGC
                      
                     TTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCAT
                      
                     CGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGA
                      
                     CTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATA
                      
                     AGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAAC
                      
                     CAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGT
                      
                     TGCCCGTCTCACTGGTGAAAAGAAAAACCACCCCAGTACATTAAAAACGTCCGCAATGT
                      
                     GTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGCCACCAGCCA
                      
                     GCCAACAGCTCCCCGACCGGCAGCTCGGCACAAAATCACCACTCGATACAGGCAGCCCA
                      
                     TCAGTCCGGGACGGCGTCAGCGGGAGAGCCGTTGTAAGGCGGCAGACTTTGCTCATGTT
                      
                     ACCGATGCTATTCGGAAGAACGGCAACTAAGCTGCCGGGTTTGAAACACGGATGATCTC
                      
                     GCGGAGGGTAGCATGTTGATTGTAACGATGACAGAGCGTTGCTGCCTGTGATCAAATAT
                      
                     CATCTCCCTCGCAGAGATCCGAATTATCAGCCTTCTTATTCATTTCTCGCTTAACCGTG
                      
                     ACAGGCTGTCGATCTTGAGAACTATGCCGACATAATAGGAAATCGCTGGATAAAGCCGC
                      
                     TGAGGAAGCTGAGTGGCGCTATTTCTTTAGAAGTGAACGTTGACGATATCAACTCCCCT
                      
                     ATCCATTGCTCACCGAATGGTACAGGTCGGGGACCCGAAGTTCCGACTGTCGGCCTGAT
                      
                     GCATCCCCGGCTGATCGACCCCAGATCTGGGGCTGAGAAAGCCCAGTAAGGAAACAACT
                      
                     GTAGGTTCGAGTCGCGAGATCCCCCGGAACCAAAGGAAGTAGGTTAAACCCGCTCCGAT
                      
                     CAGGCCGAGCCACGCCAGGCCGAGAACATTGGTTCCTGTAGGCATCGGGATTGGCGGAT
                      
                     CAAACACTAAAGCTACTGGAACGAGCAGAAGTCCTCCGGCCGCCAGTTGCCAGGCGGTA
                      
                     AAGGTGAGCAGAGGCACGGGAGGTTGCCACTTGCGGGTCAGCACGGTTCCGAACGCCAT
                      
                     GGAAACCGCCCCCGCCAGGCCCGCTGCGACGCCGACAGGATCTAGCGCTGCGTTTGGTG
                      
                     TCAACACCAACAGCGCCACGCCCGCAGTTCCGCAAATAGCCCCCAGGACCGCCATCAAT
                      
                     CGTATCGGGCTACCTAGCAGAGCGGCAGAGATGAACACGACCATCAGCGGCTGCACAGC
                      
                     GCCTACCGTCGCCGCGACCCCGCCCGGCAGGCGGTAGACCGAAATAAACAACAAGCTCC
                      
                     AGAATAGCGAAATATTAAGTGCGCCGAGGATGAAGATGCGCATCCACCAGATTCCCGTT
                      
                     GGAATCTGTCGGACGATCATCACGAGCAATAAACCCGCCGGCAACGCCCGCAGCAGCAT
                      
                     ACCGGCGACCCCTCGGCCTCGCTGTTCGGGCTCCACGAAAACGCCGGACAGATGCGCCT
                      
                     TGTGAGCGTCCTTGGGGCCGTCCTCCTGTTTGAAGACCGACAGCCCAATGATCTCGCCG
                      
                     TCGATGTAGGCGCCGAATGCCACGGCATCTCGCAACCGTTCAGCGAACGCCTCCATGGG
                      
                     CTTTTTCTCCTCGTGCTCGTAAACGGACCCGAACATCTCTGGAGCTTTCTTCAGGGCCG
                      
                     ACAATCGGATCTCGCGGAAATCCTGCACGTCGGCCGCTCCAAGCCGTCGAATCTGAGCC
                      
                     TTAATCACAATTGTCAATTTTAATCCTCTGTTTATCGGCAGTTCGTAGAGCGCGCCGTG
                      
                     CGTCCCGAGCGATACTGAGCGAAGCAAGTGCGTCGAGCAGTGCCCGCTTGTTCCTGAAA
                      
                     TGCCAGTAAAGCGCTGGCTGCTGAACCCCCAGCCGGAACTGACCCCACAAGGCCCTAGC
                      
                     GTTTGCAATGCACCAGGTCATCATTGACCCAGGCGTGTTCCACCAGGCCGCTGCCTCGC
                      
                     AACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCACGCGGGTGGAATCCGA
                      
                     TCCGCACATGAGGCGGAAGGTTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAGCTGA
                      
                     AATAGTCGAACATCCGTCGGGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAAT
                      
                     TTCGTGTAGTGGTCGCCAGCAAACAGCACGACGATTTCCTCGTCGATCAGGACCTGGCA
                      
                     ACGGGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGGTGCAGCAGCGACACCGATT
                      
                     CCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCCTGTAGGCGCGACAGG
                      
                     CATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACCAGCCCAGGTCCTGGCAAAG
                      
                     CTCGTAGAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTACTCCAACA
                      
                     CCTGCTGCCACACCAGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATC
                      
                     TTCACGTCCTTGTTGACGTGGAAAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTT
                      
                     CTTGTTGCGCGTGGTGAACAGGGCAGAGCGGGCCGTGTCGTTTGGCATCGCTCGCATCG
                      
                     TGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTGCATTTCCTTGATCTGCTGCTTC
                      
                     GTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTGACCTGTTTTGCCAGGTCCTCGCC
                      
                     GGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGGTCATCGACTTCG
                      
                     CCAAACCTGCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCG
                      
                     GGCAGGGCAGGGGGAGCCAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTG
                      
                     GACCATCGAGCCGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGTGCGGCTTG
                      
                     CGATGGTTTCGGCATCCTCGGCGGAAAACCCCGCGTCGATCAGTTCTTGCCTGTATGCC
                      
                     TTCCGGTCAAACGTCCGATTCATTCACCCTCCTTGCGGGATTGCCCCGACTCACGCCGG
                      
                     GGCAATGTGCCCTTATTCCTGATTTGACCCGCCTGGTGCCTTGGTGTCCAGATAATCCA
                      
                     CCTTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACTTGGTA
                      
                     TTCCGAATCTTGCCCTGCACGAATACCAGCGACCCCTTGCCCAAATACTTGCCGTGGGC
                      
                     CTCGGCCTGAGAGCCAAAACACTTGATGCGGAAGAAGTCGGTGCGCTCCTGCTTGTCGC
                      
                     CGGCATCGTTGCGCCACATCTAGGTACTAAAACAATTCATCCAGTAAAATATAATATTT
                      
                     TATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTT
                      
                     CTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCC
                      
                     GCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTTCACAAAGAT
                      
                     GTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCT
                      
                     TTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCG
                      
                     CAATCCACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTC
                      
                     TAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAGCCTGATGCACT
                      
                     CCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAA
                      
                     AGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTG
                      
                     CAGGACCTTTGGAACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCGTT
                      
                     CCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGGTTTTCA
                      
                     TTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCA
                      
                     GCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCCATTTATT
                      
                     ATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAACAAGA
                      
                     CGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTTTT
                      
                     TCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACC
                      
                     ACAATTATGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTG
                      
                     CTCCAGTGGCTTCTGTGTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTG
                      
                     CGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAAC
                      
                     ATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTG
                      
                     ATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCCCGCATTATGGGCGTTGGCCTC
                      
                     AACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAG
                      
                     CCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATGTCGGGGC
                      
                     TAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGTCTCCGGAAGACGGTTGTTG
                      
                     CGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCA
                      
                     CCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAA
                      
                     GGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGA
                      
                     ATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTG
                      
                     GAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGG
                      
                     AGTCATTACCCAATTATGATAGAATTTACAAGCTATAAGGTTATTGTCCTGGGTTTCAA
                      
                     GCATTAGTCCATGCAAGTTTTTATGCTTTGCCCATTCTATAGATATATTGATAAGCGCG
                      
                     CTGCCTATGCCTTGCCCCCTGAAATCCTTACATACGGCGATATCTTCTATATAAAAGAT
                      
                     ATATTATCTTATCAGTATTGTCAATATATTCAAGGCAATCTGCCTCCTCATCCTCTTCA
                      
                     TCCTCTTCGTCTTGGTAGCTTTTTAAATATGGCGCTTCATAGAGTAATTCTGTAAAGGT
                      
                     CCAATTCTCGTTTCATACCTCGGTATAATCTTACCTATCACCTCAAATGGTTCGCTGGG
                      
                     TTTATCGCACCCCCGAACACGAGCACGGCACCCGCGACCACTATGCCAAGAATGCCCAA
                      
                     GGTAAAAATTGCCGGCCCCGCCATGAAGTCCGTGAATGCCCCGACGGCCGAAGTGAAGG
                      
                     GCAGGCCGCCACCAGGCCGCCGCCCTCACTGCCCGGCACCTGGTCGCTGAATGTCGATG
                      
                     CCAGCACCTGCGGCACGTCAATGCTTCCGGGCGTCGCGCTCGGGCTGATCGCCCATCCC
                      
                     GTTACTGCCCCGATCCCGGCAATGGCAAGGACTGCCAGCGCTGCCATTTTTGGGGTGAG
                      
                     GCCGTTCGCGGCCGAGGGGCGCAGCCCCTGGGGGGATGGGAGGCCCGCGTTAGCGGGCC
                      
                     GGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCGCACAGGGC
                      
                     GCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAG
                      
                     GTTAGCGGTGGCCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTG
                      
                     GACAGCCCCTCAAATGTCAATAGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAG
                      
                     TGTCAAGGATCGCGCCCCTATCTGTCAGTAGTCGCGCCCCTCAAGTGTCAATACCGCAG
                      
                     GGCACTTATCCCCAGGCTTGTCCACATCATCTGTGGGAAACTCGCGTAAAATCAGGCGT
                      
                     TTTCGCCGATTTGCGAGGCTGGCCAGCTCCACGTCGCCGGCCGAAATCGAGCCTGCCCC
                      
                     TCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAACGTCCGCCCCTCA
                      
                     TCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGCGGTGTC
                      
                     TCGCACACGGCTTCGACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGC
                      CCAGCGGCGAGGGCAACCAGCCCGG"
     misc_feature    2454..2478
                     /note="RB T-DNA repeat"
     misc_feature    2602..2781
                     /note="NOS promoter"
     misc_feature    2838..3632
                     /note="NeoR/KanR"
     misc_feature    complement(4022..4274)
                     /note="NOS terminator"
     misc_feature    5461..5806
                     /note="CaMV 35S promoter"
     misc_feature    6747..6771
                     /note="LB T-DNA repeat"
ORIGIN
        1 tgagcgtcgc aaaggcgctc ggtcttgcct tgctcgtcgg tgatgtactt caccagctcc
       61 gcgaagtcgc tcttcttgat ggagcgcatg gggacgtgct tggcaatcac gcgcaccccc
      121 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat
      181 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc
      241 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag
      301 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc
      361 cgtgattttg tagccctggc cgacggccag caggtaggcc gacaggctca tgccggccgc
      421 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg
      481 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc
      541 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata
      601 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg
      661 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata
      721 tcgtgcgaaa aaggatggat ataccgaaaa aatcgctata atgaccccga agcagggtta
      781 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg
      841 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt
      901 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
      961 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt
     1021 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta
     1081 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt
     1141 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg
     1201 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga
     1261 cgcggtggaa agggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg
     1321 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac
     1381 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc
     1441 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg
     1501 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc
     1561 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc
     1621 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg
     1681 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg
     1741 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg
     1801 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg
     1861 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc
     1921 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa
     1981 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg
     2041 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa
     2101 cccaacatac ccctgatcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc
     2161 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc
     2221 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg
     2281 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc
     2341 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct
     2401 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc
     2461 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga
     2521 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc
     2581 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc
     2641 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc
     2701 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa
     2761 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg
     2821 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt
     2881 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg
     2941 ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg
     3001 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg
     3061 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg
     3121 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca
     3181 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc
     3241 accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc
     3301 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca
     3361 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga
     3421 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg
     3481 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg
     3541 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg
     3601 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga
     3661 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag
     3721 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct
     3781 catgctggag ttcttcgccc acgggatctc tgcggaacag gcggtcgaag gtgccgatat
     3841 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg
     3901 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg
     3961 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc
     4021 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc
     4081 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg
     4141 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata
     4201 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc
     4261 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg
     4321 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag
     4381 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta
     4441 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca
     4501 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt
     4561 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg
     4621 ctcaagtcgg tgacggtgat aattcacctt taatgaataa tttccgtcaa tatttacctt
     4681 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc
     4741 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag
     4801 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt
     4861 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca
     4921 caggaaacag ctatgaccat gattacgcca agcttgcatg cctgcaggtc cccagattag
     4981 ccttttcaat ttcagaaaga atgctaaccc acagatggtt agagaggctt acgcagcagg
     5041 tctcatcaag acgatctacc cgagcaataa tctccaggaa atcaaatacc ttcccaagaa
     5101 ggttaaagat gcagtcaaaa gattcaggac taactgcatc aagaacacag agaaagatat
     5161 atttctcaag atcagaagta ctattccagt atggacgatt caaggcttgc ttcacaaacc
     5221 aaggcaagta atagagattg gagtctctaa aaaggtagtt cccactgaat caaaggccat
     5281 ggagtcaaag attcaaatag aggacctaac agaactcgcc gtaaagactg gcgaacagtt
     5341 catacagagt ctcttacgac tcaatgacaa gaagaaaatc ttcgtcaaca tggtggagca
     5401 cgacacactt gtctactcca aaaatatcaa agatacagtc tcagaagacc aaagggcaat
     5461 tgagactttt caacaaaggg taatatccgg aaacctcctc ggattccatt gcccagctat
     5521 ctgtcacttt attgtgaaga tagtggaaaa ggaaggtggc tcctacaaat gccatcattg
     5581 cgataaagga aaggccatcg ttgaagatgc ctctgccgac agtggtccca aagatggacc
     5641 cccacccacg aggagcatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt
     5701 ggattgatgt gatatctcca ctgacgtaag ggatgacgca caatcccact atccttcgca
     5761 agacccttcc tctatataag gaagttcatt tcatttggag agaacacggg ggactctaga
     5821 ggatccccgg gtaccgagct cgaatttccc cgatcgttca aacatttggc aataaagttt
     5881 cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc tgttgaatta
     5941 cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat gggtttttat
     6001 gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa
     6061 ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat tcactggccg
     6121 tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag
     6181 cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc
     6241 aacagttgcg cagcctgaat ggcgcccgct cctttcgctt tcttcccttc ctttctcgcc
     6301 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt
     6361 agtgctttac ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc acgtagtggg
     6421 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt
     6481 ggactcttgt tccaaactgg aacaacactc aaccctatct cgggctattc ttttgattta
     6541 taagggattt tgccgatttc ggaaccacca tcaaacagga ttttcgcctg ctggggcaaa
     6601 ccagcgtgga ccgcttgctg caactctctc agggccaggc ggtgaagggc aatcagctgt
     6661 tgcccgtctc actggtgaaa agaaaaacca ccccagtaca ttaaaaacgt ccgcaatgtg
     6721 ttattaagtt gtctaagcgt caatttgttt acaccacaat atatcctgcc accagccagc
     6781 caacagctcc ccgaccggca gctcggcaca aaatcaccac tcgatacagg cagcccatca
     6841 gtccgggacg gcgtcagcgg gagagccgtt gtaaggcggc agactttgct catgttaccg
     6901 atgctattcg gaagaacggc aactaagctg ccgggtttga aacacggatg atctcgcgga
     6961 gggtagcatg ttgattgtaa cgatgacaga gcgttgctgc ctgtgatcaa atatcatctc
     7021 cctcgcagag atccgaatta tcagccttct tattcatttc tcgcttaacc gtgacaggct
     7081 gtcgatcttg agaactatgc cgacataata ggaaatcgct ggataaagcc gctgaggaag
     7141 ctgagtggcg ctatttcttt agaagtgaac gttgacgata tcaactcccc tatccattgc
     7201 tcaccgaatg gtacaggtcg gggacccgaa gttccgactg tcggcctgat gcatccccgg
     7261 ctgatcgacc ccagatctgg ggctgagaaa gcccagtaag gaaacaactg taggttcgag
     7321 tcgcgagatc ccccggaacc aaaggaagta ggttaaaccc gctccgatca ggccgagcca
     7381 cgccaggccg agaacattgg ttcctgtagg catcgggatt ggcggatcaa acactaaagc
     7441 tactggaacg agcagaagtc ctccggccgc cagttgccag gcggtaaagg tgagcagagg
     7501 cacgggaggt tgccacttgc gggtcagcac ggttccgaac gccatggaaa ccgcccccgc
     7561 caggcccgct gcgacgccga caggatctag cgctgcgttt ggtgtcaaca ccaacagcgc
     7621 cacgcccgca gttccgcaaa tagcccccag gaccgccatc aatcgtatcg ggctacctag
     7681 cagagcggca gagatgaaca cgaccatcag cggctgcaca gcgcctaccg tcgccgcgac
     7741 cccgcccggc aggcggtaga ccgaaataaa caacaagctc cagaatagcg aaatattaag
     7801 tgcgccgagg atgaagatgc gcatccacca gattcccgtt ggaatctgtc ggacgatcat
     7861 cacgagcaat aaacccgccg gcaacgcccg cagcagcata ccggcgaccc ctcggcctcg
     7921 ctgttcgggc tccacgaaaa cgccggacag atgcgccttg tgagcgtcct tggggccgtc
     7981 ctcctgtttg aagaccgaca gcccaatgat ctcgccgtcg atgtaggcgc cgaatgccac
     8041 ggcatctcgc aaccgttcag cgaacgcctc catgggcttt ttctcctcgt gctcgtaaac
     8101 ggacccgaac atctctggag ctttcttcag ggccgacaat cggatctcgc ggaaatcctg
     8161 cacgtcggcc gctccaagcc gtcgaatctg agccttaatc acaattgtca attttaatcc
     8221 tctgtttatc ggcagttcgt agagcgcgcc gtgcgtcccg agcgatactg agcgaagcaa
     8281 gtgcgtcgag cagtgcccgc ttgttcctga aatgccagta aagcgctggc tgctgaaccc
     8341 ccagccggaa ctgaccccac aaggccctag cgtttgcaat gcaccaggtc atcattgacc
     8401 caggcgtgtt ccaccaggcc gctgcctcgc aactcttcgc aggcttcgcc gacctgctcg
     8461 cgccacttct tcacgcgggt ggaatccgat ccgcacatga ggcggaaggt ttccagcttg
     8521 agcgggtacg gctcccggtg cgagctgaaa tagtcgaaca tccgtcgggc cgtcggcgac
     8581 agcttgcggt acttctccca tatgaatttc gtgtagtggt cgccagcaaa cagcacgacg
     8641 atttcctcgt cgatcaggac ctggcaacgg gacgttttct tgccacggtc caggacgcgg
     8701 aagcggtgca gcagcgacac cgattccagg tgcccaacgc ggtcggacgt gaagcccatc
     8761 gccgtcgcct gtaggcgcga caggcattcc tcggccttcg tgtaataccg gccattgatc
     8821 gaccagccca ggtcctggca aagctcgtag aacgtgaagg tgatcggctc gccgataggg
     8881 gtgcgcttcg cgtactccaa cacctgctgc cacaccagtt cgtcatcgtc ggcccgcagc
     8941 tcgacgccgg tgtaggtgat cttcacgtcc ttgttgacgt ggaaaatgac cttgttttgc
     9001 agcgcctcgc gcgggatttt cttgttgcgc gtggtgaaca gggcagagcg ggccgtgtcg
     9061 tttggcatcg ctcgcatcgt gtccggccac ggcgcaatat cgaacaagga aagctgcatt
     9121 tccttgatct gctgcttcgt gtgtttcagc aacgcggcct gcttggcctc gctgacctgt
     9181 tttgccaggt cctcgccggc ggtttttcgc ttcttggtcg tcatagttcc tcgcgtgtcg
     9241 atggtcatcg acttcgccaa acctgccgcc tcctgttcga gacgacgcga acgctccacg
     9301 gcggccgatg gcgcgggcag ggcaggggga gccagttgca cgctgtcgcg ctcgatcttg
     9361 gccgtagctt gctggaccat cgagccgacg gactggaagg tttcgcgggg cgcacgcatg
     9421 acggtgcggc ttgcgatggt ttcggcatcc tcggcggaaa accccgcgtc gatcagttct
     9481 tgcctgtatg ccttccggtc aaacgtccga ttcattcacc ctccttgcgg gattgccccg
     9541 actcacgccg gggcaatgtg cccttattcc tgatttgacc cgcctggtgc cttggtgtcc
     9601 agataatcca ccttatcggc aatgaagtcg gtcccgtaga ccgtctggcc gtccttctcg
     9661 tacttggtat tccgaatctt gccctgcacg aataccagcg accccttgcc caaatacttg
     9721 ccgtgggcct cggcctgaga gccaaaacac ttgatgcgga agaagtcggt gcgctcctgc
     9781 ttgtcgccgg catcgttgcg ccacatctag gtactaaaac aattcatcca gtaaaatata
     9841 atattttatt ttctcccaat caggcttgat ccccagtaag tcaaaaaata gctcgacata
     9901 ctgttcttcc ccgatatcct ccctgatcga ccggacgcag aaggcaatgt cataccactt
     9961 gtccgccctg ccgcttctcc caagatcaat aaagccactt actttgccat ctttcacaaa
    10021 gatgttgctg tctcccaggt cgccgtggga aaagacaagt tcctcttcgg gcttttccgt
    10081 ctttaaaaaa tcatacagct cgcgcggatc tttaaatgga gtgtcttctt cccagttttc
    10141 gcaatccaca tcggccagat cgttattcag taagtaatcc aattcggcta agcggctgtc
    10201 taagctattc gtatagggac aatccgatat gtcgatggag tgaaagagcc tgatgcactc
    10261 cgcatacagc tcgataatct tttcagggct ttgttcatct tcatactctt ccgagcaaag
    10321 gacgccatcg gcctcactca tgagcagatt gctccagcca tcatgccgtt caaagtgcag
    10381 gacctttgga acaggcagct ttccttccag ccatagcatc atgtcctttt cccgttccac
    10441 atcataggtg gtccctttat accggctgtc cgtcattttt aaatataggt tttcattttc
    10501 tcccaccagc ttatatacct tagcaggaga cattccttcc gtatctttta cgcagcggta
    10561 tttttcgatc agttttttca attccggtga tattctcatt ttagccattt attatttcct
    10621 tcctcttttc tacagtattt aaagataccc caagaagcta attataacaa gacgaactcc
    10681 aattcactgt tccttgcatt ctaaaacctt aaataccaga aaacagcttt ttcaaagttg
    10741 ttttcaaagt tggcgtataa catagtatcg acggagccga ttttgaaacc acaattatgg
    10801 gtgatgctgc caacttactg atttagtgta tgatggtgtt tttgaggtgc tccagtggct
    10861 tctgtgtcta tcagctgtcc ctcctgttca gctactgacg gggtggtgcg taacggcaaa
    10921 agcaccgccg gacatcagcg ctatctctgc tctcactgcc gtaaaacatg gcaactgcag
    10981 ttcacttaca ccgcttctca acccggtacg caccagaaaa tcattgatat ggccatgaat
    11041 ggcgttggat gccgggcaac agcccgcatt atgggcgttg gcctcaacac gattttacgt
    11101 cacttaaaaa actcaggccg cagtcggtaa cctcgcgcat acagccgggc agtgacgtca
    11161 tcgtctgcgc ggaaatggac gaacagtggg gctatgtcgg ggctaaatcg cgccagcgct
    11221 ggctgtttta cgcgtatgac agtctccgga agacggttgt tgcgcacgta ttcggtgaac
    11281 gcactatggc gacgctgggg cgtcttatga gcctgctgtc accctttgac gtggtgatat
    11341 ggatgacgga tggctggccg ctgtatgaat cccgcctgaa gggaaagctg cacgtaatca
    11401 gcaagcgata tacgcagcga attgagcggc ataacctgaa tctgaggcag cacctggcac
    11461 ggctgggacg gaagtcgctg tcgttctcaa aatcggtgga gctgcatgac aaagtcatcg
    11521 ggcattatct gaacataaaa cactatcaat aagttggagt cattacccaa ttatgataga
    11581 atttacaagc tataaggtta ttgtcctggg tttcaagcat tagtccatgc aagtttttat
    11641 gctttgccca ttctatagat atattgataa gcgcgctgcc tatgccttgc cccctgaaat
    11701 ccttacatac ggcgatatct tctatataaa agatatatta tcttatcagt attgtcaata
    11761 tattcaaggc aatctgcctc ctcatcctct tcatcctctt cgtcttggta gctttttaaa
    11821 tatggcgctt catagagtaa ttctgtaaag gtccaattct cgtttcatac ctcggtataa
    11881 tcttacctat cacctcaaat ggttcgctgg gtttatcgca cccccgaaca cgagcacggc
    11941 acccgcgacc actatgccaa gaatgcccaa ggtaaaaatt gccggccccg ccatgaagtc
    12001 cgtgaatgcc ccgacggccg aagtgaaggg caggccgcca ccaggccgcc gccctcactg
    12061 cccggcacct ggtcgctgaa tgtcgatgcc agcacctgcg gcacgtcaat gcttccgggc
    12121 gtcgcgctcg ggctgatcgc ccatcccgtt actgccccga tcccggcaat ggcaaggact
    12181 gccagcgctg ccatttttgg ggtgaggccg ttcgcggccg aggggcgcag cccctggggg
    12241 gatgggaggc ccgcgttagc gggccgggag ggttcgagaa gggggggcac cccccttcgg
    12301 cgtgcgcggt cacgcgcaca gggcgcagcc ctggttaaaa acaaggttta taaatattgg
    12361 tttaaaagca ggttaaaaga caggttagcg gtggccgaaa aacgggcgga aacccttgca
    12421 aatgctggat tttctgcctg tggacagccc ctcaaatgtc aataggtgcg cccctcatct
    12481 gtcagcactc tgcccctcaa gtgtcaagga tcgcgcccct atctgtcagt agtcgcgccc
    12541 ctcaagtgtc aataccgcag ggcacttatc cccaggcttg tccacatcat ctgtgggaaa
    12601 ctcgcgtaaa atcaggcgtt ttcgccgatt tgcgaggctg gccagctcca cgtcgccggc
    12661 cgaaatcgag cctgcccctc atctgtcaac gccgcgccgg gtgagtcggc ccctcaagtg
    12721 tcaacgtccg cccctcatct gtcagtgagg gccaagtttt ccgcgaggta tccacaacgc
    12781 cggcggccgc ggtgtctcgc acacggcttc gacggcgttt ctggcgcgtt tgcagggcca
    12841 tagacggccg ccagcccagc ggcgagggca accagcccgg
//

载体质粒图谱pdf版和相关资料下载

载体应用举例

分享到:

全部载体分类

相关载体

相关文章

相关问答

Copyright © 20012-2013 BIOFENG. 生物风 版权所有 Powered by Biofeng
欢迎您的访问和咨询....